MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`PLANT IMMUNITY INDUCTION METHOD AND PLANT IMMUNITY INDUCTION
`
`AGENT
`
`
`
`1. Technical Field
`
`[0001]
`
`BACKGROUND
`
`The present disclosure relates to a plant immunity induction method and a plant
`
`immunity induction agent.
`
`2. Description of the Related Art
`
`[0002]
`
`Conventionally, a method for helping plant growth or a method for adding
`
`additional value to a plant has been proposed.
`
`[0003]
`
`For example, Patent Literature 1 describes a plant resistance induction method
`
`in which a plant is exposed to a predetermined plant resistance induction agent. The
`
`plant resistance induction agent is synthesized when a plant receives an external
`
`stimulus, and includes a plant-derived information transmission substance whichis
`
`responsible for information transmission regarding the external stimulus. The plant-
`
`derived information transmission substanceis, for example, a short-chain aldehyde, an
`
`isoprenoid, or a planthormone.
`
`Plants are exposed to plant resistance induction
`
`agents by methods suchasdirect spraying, installation in the vicinity of the target plant,
`
`or use of an air conditioner in a greenhouse.
`
`[0004]
`
`Patent Literature 2 describes a plant treatment method in which anultra fine
`
`bubble liquid containing a predetermined substance is absorbed in a plant. The
`
`1
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`predetermined substance is a scented substance such as Japanese pepper,truffle,
`
`citron, lemon water, and black pepper.
`
`[0005]
`
`Patent Literature
`
`CITATION LIST
`
`Patent Literature 1: Japanese Patent Application Publication No. 2005-41782
`
`Patent Literature 2: Japanese Patent Application Publication No. 2014-171463
`
`[0006]
`
`SUMMARY
`
`Patent Literatures 1 and 2 fail to describe inducing plant immunity using ultra
`
`fine bubble water containing a short-chain aldehyde. Therefore, the present disclosure
`
`provides a methodfor inducing plant immunity using ultra fine bubble water containing a
`
`short-chain aldehyde.
`
`[0007]
`
`The present disclosure provides a plant immunity induction method comprising
`
`exposing a plant to ultra fine bubble water containing a short-chain aldehyde and anoily
`
`substance.
`
`[0008]
`
`According to the above method, the immunity of a plant can be induced using
`
`ultra fine bubble water containing a short-chain aldehyde.
`
`BRIEF DESCRIPTION OF THE DRAWINGS
`
`[0009]
`
`FIG.
`
`1
`
`is a graph showing an expression level of SIPR1 gene in samples
`
`according to the inventive examples and the comparative example.
`
`FIG. 2 is a graph showing an expression level of TPP3 gene in the samples
`
`according to the inventive examples and the comparative example.
`
`FIG. 3 is a graph showing an expression level of NP24 gene in the samples
`
`according to the inventive examples and the comparative examples.
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`FIG. 4 is a graph showing an expression level of SIOSM gene in the samples
`
`according to the inventive examples and the comparative examples.
`
`FIG. 5 is a graph showing an expression level of SITSRF1 gene in the samples
`
`according to the inventive examples and the comparative examples.
`
`FIG. 6 is a graph showing an expression level of PR5L gene in the samples
`
`according to the inventive examples and the comparative examples.
`
`DETAILED DESCRIPTION OF THE EMBODIMENT
`
`[0010]
`
`(Findings which have established the foundation of the present disclosure)
`
`For example, a plant
`
`that has suffered from insect damage releases a
`
`predetermined information transmission substance. When a surrounding plant receives
`
`the information transmission substance,
`
`immunity of the plant is induced. Thus, a
`
`mechanism in which a plant transmits information using a predetermined substanceis
`
`referred to as inter-plant communication. By applying this mechanism, it is conceivable
`
`that, if a plant is exposed to an information transmission substance such as short-chain
`
`aldehydes, plant
`
`immunity can be induced.
`
`For example, according to the method
`
`described in Patent Literature 1, a plant
`
`is exposed to a plant-derived information
`
`transmission substance such as a short-chain aldehyde. On the other hand, the present
`
`inventors have made a greatdealof trial and error in order to develop a technique capable
`
`of stably causing a short-chain aldehyde to be present around a plant using ultra fine
`
`bubble water. As a result, the present inventors have newly found that, by including an
`
`oily substance along with the short-chain aldehyde in the ultra fine bubble water, the short-
`
`chain aldehyde is stably present around the plant, and that immunity of the plant is easily
`
`induced. The present inventors have made the method of the present disclosure based
`
`on these newfindings.
`
`[0011]
`
`(Outline of aspect according to present disclosure)
`
`The plant immunity induction method according to the first aspect of the present
`
`disclosure comprises exposing a plant to ultra fine bubble water containing a short-chain
`
`aldehyde and an oily substance.
`
`[0012]
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`According to the first aspect, life of ultra fine bubbles in the ultra fine bubble water
`
`tends to be made long due to a function of the oily substance. As a result, the short-
`
`chain aldehyde can be stably present around the plant, and plant immunity is easily
`
`induced.
`
`[0013]
`
`In the second aspect of the present disclosure, in the method according to the
`
`first aspect, the short-chain aldehyde mayinclude at least one selected from (E)-2-
`
`hexenal and (Z)-3-hexenal. According to the second aspect, the plant immunity is easily
`
`induced morereliably.
`
`[0014]
`
`In the third aspect of the present disclosure, in the method according to the first
`
`aspect or the second aspect, the oily substance may be naturally derived. According to
`
`the third aspect, since the oily substance contained in the ultra fine bubble water is
`
`naturally derived, even if
`
`the plant
`
`is brought
`
`into contact with the oily substance
`
`containedin the ultra fine bubble water, the plant is less likely to be damaged.
`
`[0015]
`
`In the fourth aspect of the present disclosure, in the method according to the third
`
`aspect, the oily substance may include squalene. According to the fourth aspect, the
`
`short-chain aldehyde can be stably present more reliably around the plant due to a
`
`function of the squalene.
`
`[0016]
`
`In the fifth aspect of the present disclosure, in the method according to the third
`
`aspect, the oily substance mayinclude oleic acid. According to the fifth aspect, the
`
`short-chain aldehyde can be stably present more reliably around the plant due to a
`
`function of the oleic acid.
`
`[0017]
`
`In the sixth aspect of the present disclosure, in the method according to any one
`
`of the first to fifth aspects, a concentration of the short-chain aldehyde in the ultra fine
`
`bubble water may be not less than 1 wumol/liter and not more than 1,000 umol/liter.
`
`According to the sixth aspect, a desired amount of the short-chain aldehyde can be stably
`
`present around the plant.
`
`[0018]
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`In the seventh aspect of the present disclosure, in the method according to any
`
`one ofthe first to sixth aspects, at least a part of the plant may be immersed in the ultra
`
`fine bubble water. According to the sixth aspect, the short-chain aldehyde can be stably
`
`present at a high concentration around the plant.
`
`[0019]
`
`According to the eighth aspectof the present disclosure, in the method according
`
`to the seventh aspect, a root of the plant may be immersedin the ultra fine bubble water.
`
`According to the eighth aspect, the short-chain aldehyde is absorbed from the roots of
`
`the plant, so that the short-chain aldehyde is easily carried throughout the plant. Asa
`
`result, immunity is easily inducedin the entire of the plant.
`
`[0020]
`
`The plant immunity induction agent according to the ninth aspect of the present
`
`disclosure comprises ultra fine bubble water, a short-chain aldehyde containedin the ultra
`
`fine bubble water, and an oily substance contained in the ultra fine bubble water. The
`
`plant immunity induction method according to the first aspect can be carried out using the
`
`plant immunity induction agent.
`
`[0021]
`
`(Embodiment)
`
`Hereinafter, an embodiment of the present disclosure will be described. The
`
`following embodiment is merely an example, and the plant immunity induction method
`
`and the plant immunity induction agent of the present disclosure are not limited to the
`
`following embodiment.
`
`[0022]
`
`In the plant immunity induction method of the present disclosure, a plant immunity
`
`induction agent is used. The plant immunity induction agent comprises ultra fine bubble
`
`water, a short-chain aldehyde, and an oily substance. The short-chain aldehydes are
`
`containedin the ultra fine bubble water. The oily substance is contained in the ultra fine
`
`bubble water. Aplantis exposed to the ultra fine bubble water containing the short-chain
`
`aldehyde and the oily substance using the plant immunity induction agent.
`
`In the present
`
`specification,
`
`the oily substance is typically a substance that has fluidity at
`
`room
`
`temperature (20 °C. + 15 °C.: Japanese Industrial Standards JIS Z 8703) and is insoluble
`
`in water. An example of the oily substance is a substance containing squalene and a
`
`5
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`fatty acid.
`
`[0023]
`
`Life of the ultra fine bubbles in the ultra fine bubble water tends to be prolonged
`
`due to the function of the oily substance. As a result, the short-chain aldehyde can be
`
`stably present around the plant, and the plant immunity is easily induced.
`
`[0024]
`
`In ultra fine bubble water, ultra fine bubbles are dispersed in water.
`
`In the
`
`present specification, “ultra fine bubbles” are bubbles each having a bubble diameter of
`
`less than 1 um in accordance with ISO 20480-1: 2017. A mode of a diameter of the
`
`bubbles in the ultra fine bubble water is, for example, less than 1,000 nm, or may be not
`
`more than 500 nm, not more than 300 nm, not more than 200 nm, not less than 50 nm
`
`and not more than 150 nm. The mode of the diameter of the bubbles in the ultra fine
`
`bubble water can be determined by, for example, a nanoparticle tracking analysis method.
`
`[0025]
`
`A gasin the ultra fine bubbles is not limited to a specific gas, as long asthe ultra
`
`fine bubbles can be formed. The gasin the ultra fine bubbles is at least one selected
`
`from the group consisting of an air, an oxygen gas, a nitrogen gas, a carbon dioxide gas,
`
`an ozone gas, a neon gas, and an argon gas, for example. The gasin the ultra fine
`
`bubbles may be an air, an oxygen gas, or a nitrogen gas. The gasin the ultra fine
`
`bubbles may be an oxygen gas.
`
`[0026]
`
`The water as a dispersion medium in the ultra fine bubble water is, for example,
`
`tap water, purified water,
`
`ion exchange water, pure water, ultra pure water, deionized
`
`water, or distilled water.
`
`[0027]
`
`The concentration of the ultra fine bubbles in the ultra fine bubble water is not
`
`limited to a specific concentration, as long as the plant immunity can be induced. The
`
`concentration of the ultra fine bubbles in the ultra fine bubble water is, for example, not
`less than 1x10° /mL (milliliter), or may be not less than 1x10° /mL, not less than 1107
`
`/mL, not less than 1x108 /mL, or not less than 1x108 /mL and not more than 1109 /mL.
`
`The concentration of
`
`the ultra fine bubbles in the ultra fine bubble water can be
`
`determined, for example, by a nanoparticle tracking analysis method.
`
`6
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`[0028]
`
`The ultra fine bubble water can be prepared, for example, by a known method
`
`such as a gas-liquid mixing shear method, a static mixer method, a venturi method, a
`
`cavitation method, a vapor condensation method, an ultrasonic method, a swirl flow
`
`method, a pressure dissolution method, or a micropore method.
`
`[0029]
`
`The short-chain aldehydes typically have carbon atoms of not more than 10.
`
`The short-chain aldehyde is not particularly limited, as long as the plant immunity can be
`
`induced. The short-chain aldehydes may include an aldehyde having six carbon atoms.
`
`The short-chain aldehyde may contain at least one selected from (E)-2-hexenal and (Z)-
`
`3-hexenal. These short-chain aldehydes are often contained in a scent emitted by
`
`plants, and arelikely to activate the plant immunity.
`
`[0030]
`
`The concentration of the short-chain aldehyde in the ultra fine bubble water is not
`
`limited to a specific concentration, as long as the plant immunity can be induced. The
`
`concentration of the short-chain aldehyde in the ultra fine bubble water is not less than 1
`
`micromol/L and not more than 1,000 micromol/L, for example. Thus, the plant immunity
`
`is easily induced.
`
`[0031]
`
`The oily substance contained in the ultra fine bubble water is naturally derived,
`
`for example. The oily substance may be extracted or purified from animals or plants.
`
`In this case, even if the plant is brought into contact with the oily substance contained in
`
`the ultra fine bubble water, the plant is less likely to be damaged.
`
`[0032]
`
`The fatty acid as the oily substanceis, for example, a saturated fatty acid having
`
`carbon atoms of not less than 5 and not more than 12 or an unsaturated fatty acid having
`
`carbon atoms of not less than 12. The oily substance may have carbon atoms of not
`
`less than 12.
`
`The fatty acid as the oily substance may be at least one selected from the
`
`group consisting of oleic acid, octanoic acid, nonanoic acid, palmitoleic acid, linoleic acid,
`
`a-linolenic acid, and arachidonic acid. The fatty acid as the oily substance mayinclude
`
`oleic acid. The oily substance may include squalene. These oily substances are
`
`adsorbed on the ultra fine bubbles and can be stably dispersed without agglutination in
`
`7
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`the ultra fine bubble water. As aresult, the concentration of the ultra fine bubbles in the
`
`ultra fine bubble water can be maintained high.
`
`In addition, the life of the ultra fine
`
`bubbles can be extended.
`
`[0033]
`
`The concentration of the oily substance contained in the ultra fine bubble water
`
`is not limited to a specific concentration, as long as the plant immunity can be induced.
`
`The concentration of the oily substance in the ultra fine bubble water is, for example, not
`
`less than 1x10-3 ppm (parts per million) on a mass basis. As aresult, the concentration
`
`of the ultra fine bubbles in the ultra fine bubble water is easy to be maintained high. The
`
`concentration of the oily substancein the ultra fine bubble water is, for example, not more
`
`than 50 ppm.
`
`[0034]
`
`The method for exposing the plant to the ultra fine bubble water is notlimited to
`
`a specific method, as long as the immunity of the plant can be induced.
`
`For example, at
`
`least a part of the plant is immersedin the ultra fine bubble water. When the plant is
`
`immersedin the ultra fine bubble water, the short-chain aldehyde is stably present at a
`
`high concentration around the plant. As a result, the plant immunity is easily induced
`
`morereliably.
`
`[0035]
`
`A root of the plant may be immersedin the ultra fine bubble water.
`
`In this case,
`
`since the short-chain aldehyde is absorbed from the root of the plant, the short-chain
`
`aldehyde is easily transported to the whole of the plant. As a result, immunity is easily
`
`induced in the whole of the plant.
`
`[0036]
`
`A part of the plant immersedin the ultra fine bubble water may be a part other
`
`than the root.
`
`For example, a stem, a branch, a leaf, a flower, or a fruit of the plant may
`
`be immersed in the ultra fine bubble water.
`
`[0037]
`
`The plant may be exposedto the ultra fine bubble water by spraying the ultra fine
`
`bubble water to the plant.
`
`[0038]
`
`The plant to which the immunity induction method of the present disclosure is
`
`8
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`applied is not limited to a specific plant.
`
`For example, the immunity induction method of
`
`the present disclosure can be applied to edible plants, ornamental plants, feed plants, or
`
`plants which are cultivated to provide industrial raw materials.
`
`[0039]
`
`EXAMPLES
`
`The plant immunity induction method and the plant immunity induction agent of
`
`the present disclosure will be described in more detail with reference to the examples.
`
`Note that the plant immunity induction method and the plant immunity induction agent of
`
`the present disclosure are not limited to the following examples.
`
`[0040]
`
`(Inventive example)
`
`Water containing (E)-2-hexenal and squalene was treated using a pressure-
`
`dissolving microbubble generator to prepare ultra fine bubble water containing the (E)-2-
`
`hexenal and the squalene. Using a nanoparticle analysis system (product of NanoSight
`
`Ltd., product name: LM10) under conditions of 25 °C. and 1 atm, the bubble diameter and
`
`the concentration of fine bubbles in the ultra fine bubble water were measured according
`
`to the nanoparticle tracking analysis method. According to the nanoparticle tracking
`
`analysis method, the bubble diameter and the number of the ultra fine bubbles (i.e.,
`
`concentration) are calculated based on the Stokes-Einstein equation from moving speed
`
`of the fine bubbles in Brownian motion confirmed with the laser scattered light. Asa
`
`result of the measurement, the mode of the diameter of the bubbles in the ultra fine bubble
`
`water was 70.3 nm.
`
`[0041]
`
`The aboveultra fine bubble water wasdiluted with Milli-Q water in such a manner
`
`that the concentrations of (E)-2-hexenal were 1 uM, 10 uM, and 1 mM (millimolar: 10-°
`
`mol/dm*) after conversion with an addition amount of the (E)-2-hexenal
`
`to provide
`
`immunity induction agents A, B, and C, respectively. The concentration of the ultra fine
`bubbles in the immunity induction agent A was 4.5x10°/mL.
`The concentration of
`
`squalene in the immunity induction agent A was 2.9x10-* ppm on a massbasis.
`
`[0042]
`
`Seeds of Micro Tom tomato were planted on a sponge moistened with water and
`
`9
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`allowed to stand in the dark at room temperature until germination thereof. After the
`
`germination, the Micro Tom tomatoes were cultivated by hydroponics using hyponica
`
`liquid fertilizer as a cultivation nutrient solution. The cultivation nutrient solution was a
`
`liquid provided by 500-fold diluting an A agent and a B agent with tap water. The Micro
`
`Tom tomatoes were cultivated for two weeks under conditions of a temperature of 20 °C.,
`
`a light period of 12 hours, and a dark period of 12 hours. Root parts of the 2-week-old
`
`Micro Tom tomatoes were rinsed and washed with tap water, and then, immersed in 30
`
`mL of the immunity induction agent A, the immunity induction agent B, or the immunity
`
`induction agent C for three hours.
`
`In this way, the Micro Tom tomatoes were exposed to
`
`the immunity induction agent A,
`
`the immunity induction agent B, and the immunity
`
`induction agent C to provide a sample A, a sample B, and a sample C of the Micro Tom
`
`tomatoes, respectively.
`
`[0043]
`
`(Comparative example 1)
`
`Water containing squalene was treated using the pressure-dissolving microbubble
`
`generator to prepare ultra fine bubble water containing the squalene.
`
`Using the
`
`nanoparticle analysis system (product of NanoSight Ltd., product name: LM10) under
`
`conditions of 25 °C. and 1 atm, the bubble diameter and the concentration of fine bubbles
`
`in the ultra fine bubble water were measured according to the nanoparticle tracking
`
`analysis method. The mode of the diameter of the bubbles in the ultra fine bubble water
`
`was 98 nm.
`
`[0044]
`
`The above ultra fine bubble water was diluted with Milli-Q water to provide an
`
`immersion liquid according to the comparative example 1. The concentration of the ultra
`
`fine bubbles in the immersion liquid according to the comparative example 1 was
`2.9x108/mL. The concentration of squalene in the immersion liquid according to the
`
`comparative example 1 was 5 ppm on a massbasis.
`
`[0045]
`
`The Micro Tom tomato was exposed in the immersion liquid according to the
`
`comparative example 1 similarly to the case of the inventive example to provide a sample
`
`of the Micro Tom tomato according to the comparative example 1, except that the
`
`immersion liquid according to the comparative example 1 was used in place of the
`
`10
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`immunity induction agent A, the immunity induction agent B, and the immunity induction
`
`agent C.
`
`[0046]
`
`(Comparative example 2)
`
`Exceptfor using Milli-Q water in place of the immunity induction agent A, immunity
`
`induction agent B, or immunity induction agent C, the Micro Tom tomato was exposedto
`
`the Milli-Q water similarly to the case of the inventive example to provide a sample of the
`
`Micro Tom tomato according to the comparative example 2.
`
`[0047]
`
`(Comparative example 3)
`
`The present inventors attempted to prepare ultra fine bubble water containing (E)-
`
`2-hexenal similarly to the case of the inventive example, except that squalene was not
`
`added, and that only (E)-2-hexenal was added. However, ultra fine bubble water having
`
`a sufficient concentration of ultra fine bubbles failed to be prepared.
`
`[0048]
`
`<Gene Expression Analysis>
`
`The following treatments were performed on each of the samples A, B, and C,
`
`and the samples according to the comparative example 1 and 2. Leaves of the Micro
`
`Tom tomatoes were cut.
`
`Total RNAs were extracted using an RNA extraction kit;
`
`ISOSPIN Plant RNA (manufactured by Nippon Gene). Next, cDNA was synthesized
`
`from the total RNAs using a Transcriptor first strand cDNA synthesis kit (product of Roche
`
`Diagnostics). The operation was performed in accordance with the kit protocol. Gene
`
`expression analysis was performed using this cDNA. The target genes and gene-
`
`specific primer sequences are shownin Table 1.
`
`For primer sequences, the present
`
`inventors referenced Journal of Plants, Physiology, 2016, v. 202, pp. 107-120. Apart of
`
`the primer sequences was designed using a PCR primer design tool (Primer 3). The
`
`synthesized cDNA and the primers were subjected to expression analysis using a
`
`standard protocol using Maxima SYBR Green qPCR Master Mix (2X), with separate ROX
`
`vial (product of Thermo Fisher Scientific). The used apparatus was QuantStudio 3
`
`System (Applied Biosystems), and QuantStudio Design & Analysis software (productof
`
`Applied Biosystems) was usedfor the analysis. Arelative value of the gene expression
`
`level was determined using EF1a as an internal standard. The results are shownin FIG.
`
`11
`
`P1017216
`
`

`

`MARKEDUP VERSION OF SUBSTITUTE SPECIFICATION
`
`1 to FIG. 6.
`
`[0049]
`
`As shownin FIG.
`
`1
`
`to FIG. 6, expression enhancement of SIPR1, TPP3, NP24,
`
`SIOSM, SITSRF1, and PR5L genes was observed in the sample A, the sample B, and
`
`the sample C, which were immersed in the immunity induction agent A, the immunity
`
`induction agent B, and the immunity induction agent C, respectively. As just proved, the
`
`expression enhancement of six kinds of infection-relevant genes was observed in the
`
`samples in which the roots of the plants were exposedto the ultra fine bubble water
`
`containing squalene and (E)-2-hexenal. This suggests that, due to containing squalene,
`
`the ultra fine bubbles are maintained for a long time, the Micro Tom tomatoes are exposed
`
`appropriately to (E)-2-hexenal, and that, as a result, immunoactivity of the Micro Tom
`
`tomatoes is improved.
`
`12
`
`P1017216
`
`

`

`MARKEDUPVERSIONOF SUBSTITUTESPECIFICATION
`
`CACCATATGGACGTTGTCCTCTCCA
`(SEQ ID NO: 02
`
`TGAGATGTAACTCTTATTCCGGTCT
`(SEQ ID NO: 06
`
`) ) )
`
`[0050]
`
`[Table 1]
`
`SIPR1
`
`TPP3
`
`NP24
`
`SIOSM
`
`GGTGGTGTGGCGTAACTCGGT
`(SEQ ID NO: 01
`
`TCACTCATTCCATGGCTCGT
`(SEQ ID NO: 03)
`
`CGCCTCAAATAGTCAACTGATCTC
`(SEQ ID NO: 05
`
`) ) 1
`
`TCTACCTCATAGGTAACAAAGAGCA
`(SEQ ID NO: 04
`
`CCGCTCCCAACGCTCACTGG
`(SEQ ID NO: 07)
`
`GGCACCACCGAGTCCATCGC
`(SEQ ID NO: 08)
`
`SITSRF1|GCGCGGAAGATGCTGCTTTAGCTT|GCGCCACTACAGGGGAGCAA
`(SEQ ID NO: 09)
`(SEQ ID NO: 10
`
`PR5L
`
`EFta
`
`CAAAGTTGGTGGTTTTGGGCT
`(SEQ ID NO: 11)
`
`CCAACCTCTACCAGCACCAT
`(SEQ ID NO: 12
`
`GCTGCTGTAACAAGATGGATGC
`(SEQ ID NO: 13)
`
`AGGGGATTTTGICAGGGTTGT
`(SEQ ID NO: 14)
`
`3
`
`P1017216
`
`